View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_35 (Length: 420)
Name: NF17152_low_35
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 15 - 253
Target Start/End: Complemental strand, 28791651 - 28791414
Alignment:
| Q |
15 |
agtataatatccgactgatgctagcagctagctaggggaatagcagaaaaacatggttgcactataatagtcttcgggaacatacttcgttttctttgcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
28791651 |
agtataatatccgactgatgctagcagctagccaggggaatagcagaaaaacatggttgcactataatagtcttcgggaacatacctcgttt-ctttgcc |
28791553 |
T |
|
| Q |
115 |
tttattgctgttaatattgcgattcgatgcacaccttgaatggctaaaggctattaatgaatgtatatcggtaaatgtcatattttgtgcctcaaaaata |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28791552 |
tttattgctgttaatattgctattcgatgcacaccttgaatggctaaaagctattaatgaatgtatatcggtaaatgtcatattttgtgcctcaaaaata |
28791453 |
T |
|
| Q |
215 |
atagtggaaggtctagaggcaaagaaatcactatatatg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28791452 |
atagtggaaggtctagaggcaaagaaatcactatatatg |
28791414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 293 - 419
Target Start/End: Complemental strand, 28791374 - 28791248
Alignment:
| Q |
293 |
cttaagatggaggtgctttccaataagattgacaggaaacaactgaaaaccggagatcacatctactcttggaggcaggcttacgtctatgcacatcatg |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28791374 |
cttaagatggaggtgctttccaataagattgataggaaacaactgaaaaccggagatcacatctactcttggaggcaggcttacgtctatgcacatcatg |
28791275 |
T |
|
| Q |
393 |
gtcatatcttttctcttatattcatct |
419 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28791274 |
gtcatatcttttctcttatattcatct |
28791248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 329 - 420
Target Start/End: Complemental strand, 28784349 - 28784258
Alignment:
| Q |
329 |
aaacaactgaaaaccggagatcacatctactcttggaggcaggcttacgtctatgcacatcatggtcatatcttttctcttatattcatctc |
420 |
Q |
| |
|
|||||| ||||| | ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||| |||||| |||||||||| |
|
|
| T |
28784349 |
aaacaattgaaagctggagatcacatctactcttggaggcaggcttacatctatgctcatcatggtcatctcttctctcttttattcatctc |
28784258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 187 - 242
Target Start/End: Complemental strand, 28787512 - 28787455
Alignment:
| Q |
187 |
aaatgtcatattttgtgcctcaaaaata--atagtggaaggtctagaggcaaagaaat |
242 |
Q |
| |
|
|||||||||||| | ||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
28787512 |
aaatgtcatattgtttgcctcaaaaatataataggggaaggtctagaggcaaagaaat |
28787455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University