View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_54 (Length: 351)
Name: NF17152_low_54
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_54 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 417419 - 417751
Alignment:
| Q |
1 |
tgaaatgtaaatttcagaaggaaattgacgaacttcgcttgaagtatgctgaacttcacaaagaatgtgagaggagattaccgctgaaatgggtatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417419 |
tgaaatgtaaatttcagaaggaaattgacgaacttcgcttgaagtatgctgaacttcacaaagaatgtgagaggagattaccgctgaaatgggtatttga |
417518 |
T |
 |
| Q |
101 |
gaatcaaattaagatactttgcaaccgctatggtattgaactgaacaacattgaggttgaatttcaaagagcatcggagagttatgacgcacaacataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
417519 |
gaatcaaattaagatactttgcaaccgctatggtattgaactgaacaacattgaggttgaatttcaaagagcatcggagagttatgacgcacaatataaa |
417618 |
T |
 |
| Q |
201 |
atagttcatgtgcataaaatattggccgatgctatgagtgctaggtctaaacttgagttttttagtgcacctcaaatgctgcaaggtatactccaatatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417619 |
atagttcatgtgcataaaatattggccgatgctatgagtgctaggtctaaacttgagttttttagtgcacctcaaatgctgcaaggtatactccaatatc |
417718 |
T |
 |
| Q |
301 |
ctgactgctgtagttgttgactatatacttttt |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
417719 |
ctgactgctgtagttgttgactatatacttttt |
417751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 263
Target Start/End: Original strand, 45327299 - 45327347
Alignment:
| Q |
214 |
ataaaatattggccgatgctatgagtgctaggtctaaacttgagtttttt |
263 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| ||||| |||||||||| |
|
|
| T |
45327299 |
ataagatattggccgatgctatgaatgctaggtttaaac-tgagtttttt |
45327347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University