View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_66 (Length: 296)
Name: NF17152_low_66
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 122 - 285
Target Start/End: Original strand, 41246914 - 41247078
Alignment:
| Q |
122 |
gaataaagtaaatagataaatttatacactaattaatttggtttgaccaatctaatnnnnnnnnn-gtttggccgaagatataggaannnnnnnngaagg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||| |
|
|
| T |
41246914 |
gaataaagtaaatagataaatttatacactaattaatttggtttgaccaatctaataaaaaaaaaagtttgaccgaagatataggaaatttttttgaagg |
41247013 |
T |
 |
| Q |
221 |
gatataggaattgtttgttatacacttgaaaatattatttgtcacgttgtaggagttcaactcat |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41247014 |
gatataggaattgtttgttatacacttgaaaatattatttgtcacgttgtaggagttcaattcat |
41247078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University