View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17152_low_70 (Length: 286)

Name: NF17152_low_70
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17152_low_70
NF17152_low_70
[»] chr4 (1 HSPs)
chr4 (53-273)||(27300615-27300831)


Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 53 - 273
Target Start/End: Original strand, 27300615 - 27300831
Alignment:
53 gagtggtagttctaaactcagtaaatggttttattgtagagttttcattatgcatattatatgattgatgaaagatgtacatgcaatggtattagaccac 152  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||   |||||||||| ||||||||||| |||||||||||||||||    
27300615 gagtggtagttctaaactcagtaaatggttttattgtagagttt-cattatgcatat---atgattgatgcaagatgtacatacaatggtattagaccac 27300710  T
153 gtagtaaattttgcaattaaacaaatgggaccatattatcctgccacccaccaccatcaatatcatgagtgaatggtggaatatataactaaacgaaaat 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
27300711 gtagtaaattttgcaattaaacaaatgggaccatattatcctgccacccaccaccatcaatatcatgagtgaatggtcgaatatataactaaacgaaaat 27300810  T
253 tgaaagctcgtgtgaacttgt 273  Q
    ||||||||| |||||||||||    
27300811 tgaaagctcatgtgaacttgt 27300831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University