View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_70 (Length: 286)
Name: NF17152_low_70
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 53 - 273
Target Start/End: Original strand, 27300615 - 27300831
Alignment:
| Q |
53 |
gagtggtagttctaaactcagtaaatggttttattgtagagttttcattatgcatattatatgattgatgaaagatgtacatgcaatggtattagaccac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
27300615 |
gagtggtagttctaaactcagtaaatggttttattgtagagttt-cattatgcatat---atgattgatgcaagatgtacatacaatggtattagaccac |
27300710 |
T |
 |
| Q |
153 |
gtagtaaattttgcaattaaacaaatgggaccatattatcctgccacccaccaccatcaatatcatgagtgaatggtggaatatataactaaacgaaaat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27300711 |
gtagtaaattttgcaattaaacaaatgggaccatattatcctgccacccaccaccatcaatatcatgagtgaatggtcgaatatataactaaacgaaaat |
27300810 |
T |
 |
| Q |
253 |
tgaaagctcgtgtgaacttgt |
273 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
27300811 |
tgaaagctcatgtgaacttgt |
27300831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University