View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_72 (Length: 286)
Name: NF17152_low_72
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 19 - 267
Target Start/End: Complemental strand, 44842598 - 44842350
Alignment:
| Q |
19 |
gttattgttggtaatttgaaatatatgctccggtagaacattagaaaaagaaccgtgataatttgaaagtaaatgaagtttatatgagtatactgatgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44842598 |
gttattgttggtaatttgaaatatatgctccggtagaacattagaaaaagaaccgtgataatttgaaagtaaatgaagtttatatgagtatactgatgat |
44842499 |
T |
 |
| Q |
119 |
aagggatactgaacacatagaagagattagtttgatgagtgcaaagcagaaagccaaaaaactctagtagtattcccttgaatgatatctcttaatttga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44842498 |
aagggatactgaacacatagaagagattagtttgatgagtgcaaagcagaaagccaaaaaactctagtagtattcccttgaatgatatctcttaatttga |
44842399 |
T |
 |
| Q |
219 |
gttattcttataaaatagaatgcattatactctatgaaatcaaaaatag |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44842398 |
gttattcttataaaatagaatgcattataccctatgaaatcaaaaatag |
44842350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University