View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_73 (Length: 283)
Name: NF17152_low_73
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 267
Target Start/End: Original strand, 36286829 - 36287077
Alignment:
| Q |
20 |
acgacggtatttggccaaaaatcgaaaaagctgaaaggtggtgctgtcggcgcaaatgccgccgccagcaaccgcagtgaatcacagagactggtcacaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
36286829 |
acgacggtatttggccaaaaatcgaaaaagctgaaaggtggtgctgttggcgcaaatgccgccgccagcaaccgcagtgaatcacagagacaggtcataa |
36286928 |
T |
 |
| Q |
120 |
aatcataacctgctctgatgccatgtacacagaaatacaatttctacagtaactaactcccaaccgtctc-taactaactagaaccagctaactaacttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36286929 |
aatcataacctgctctgatgccatgtacacagaaatacaatttctacagtaactaactcccaaccgtctcataactaactagaaccagctaactaacttc |
36287028 |
T |
 |
| Q |
219 |
agttaagtagttataagagtaggatcataagcttcatctggttgaatgg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36287029 |
agttaagtagttataagagtaggatcataagcttcatctggttgaatgg |
36287077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 55 - 146
Target Start/End: Complemental strand, 22822701 - 22822609
Alignment:
| Q |
55 |
aggtggtgctgtcggcg-caaatgccgccgccagcaaccgcagtgaatcacagagactggtcacaaaatcataacctgctctgatgccatgta |
146 |
Q |
| |
|
||||||||||| |||| |||||||||||||| ||||| |||||| |||||||| |||||||||||| |||| ||||| || ||||||| |
|
|
| T |
22822701 |
aggtggtgctgctggcggcaaatgccgccgccggcaacaatagtgaagcacagagaaatgtcacaaaatcagaaccagctctaataccatgta |
22822609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University