View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_79 (Length: 273)
Name: NF17152_low_79
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_79 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 262
Target Start/End: Complemental strand, 2943536 - 2943290
Alignment:
| Q |
16 |
aaatccctaaacttgaagatcaatgaaactatacaactggaatggtnnnnnnncaatatgctgaagttgaccaaatggttcagcatagtacctccatcaa |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2943536 |
aaatacctaaacttgaagatcaatgaaactatacaactggaatggtaaaaaaacaatatgctgaagttgaccaaatggttcagcatagtacctccatcaa |
2943437 |
T |
|
| Q |
116 |
cgtgatctctttggagcaatcaaactgcaacacaacataaccaaacttgaaacatattctaattaatattgtgtagtgaccttaattaaatataagtatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2943436 |
cgtgatctctttggagcaatcaaactgcaacacaacataaccaaacttgaaaaatattctaattaatattgtgtagtgaccttaattaaatataagtatc |
2943337 |
T |
|
| Q |
216 |
tggacatgcatttgttattttccttgccatgtgatgcagtcaattca |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2943336 |
tggacatgcatttgttattttccttgccatgtgatgcagtcaattca |
2943290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University