View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_82 (Length: 256)
Name: NF17152_low_82
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_82 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 12 - 238
Target Start/End: Complemental strand, 32606261 - 32606035
Alignment:
| Q |
12 |
atgaaaatacgacacaaacaaaaggctcgcttcggatttatactccacatttgatgtatccctttctacattttctgatgtgggacttaaaatactgctg |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32606261 |
atgaaaatatgacacaaacaaaaggctcgcttcggatttatactccacatttgatgtatccctttctacattttctgatgtgggacttaaaatactgctg |
32606162 |
T |
|
| Q |
112 |
catgtgttatgggtcattgtgacttccttttttcttatgaaaaagatcggtggacatccaaaatcctttgacacctttagagagaaaaacagagcgaata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32606161 |
catgtgttatgggtcattgtgacttccttttttcttatgaaaaagatcggtggacatccaaaatcctttgacacctttagagagaaaaacagagcgaata |
32606062 |
T |
|
| Q |
212 |
atgtgatagatgtgatagagatagaga |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32606061 |
atgtgatagatgtgatagagatagaga |
32606035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 28 - 131
Target Start/End: Complemental strand, 32574021 - 32573918
Alignment:
| Q |
28 |
aacaaaaggctcgcttcggatttatactccacatttgatgtatccctttctacattttctgatgtgggacttaaaatactgctgcatgtgttatgggtca |
127 |
Q |
| |
|
|||||| ||||| ||||||||||||| ||||||||| |||| || ||| ||||||| |||||||||||||||| |||| || ||||||| ||||||| |
|
|
| T |
32574021 |
aacaaagggctcccttcggatttatattccacatttacagtatttctctctgcattttcagatgtgggacttaaaacactgatgtatgtgttttgggtca |
32573922 |
T |
|
| Q |
128 |
ttgt |
131 |
Q |
| |
|
|||| |
|
|
| T |
32573921 |
ttgt |
32573918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University