View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_84 (Length: 250)
Name: NF17152_low_84
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_84 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 417424 - 417190
Alignment:
| Q |
1 |
atttcagcagtaatctctgctccaacaatgggataatatagcagttatcattaaatgaatgtaagatatcaaatctaaataactattctcatagcaatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417424 |
atttcagcagtaatctctgctccaacaatgggataatatagcagttatcattaaaggaatgtaagatatcaaatctaaataactattctcatagcaatga |
417325 |
T |
 |
| Q |
101 |
gtagagcagaaacttactattttctgaatcctttctaattcatgacaaagtggattatggtacaaaggtggaagattcatcacagatgattgtggtgcag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417324 |
gtagagcagaaacttactattttctgaatcctttctaattcatgacaaagtggtttatggtacaaaggtggaagattcatcacagatgattgtggtgcag |
417225 |
T |
 |
| Q |
201 |
cttcaataggatgattcctcaaaccaggatttctt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
417224 |
cttcaataggatgattcctcaaaccaggatttctt |
417190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University