View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_91 (Length: 236)
Name: NF17152_low_91
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_91 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 45106517 - 45106301
Alignment:
| Q |
1 |
ctcaaactatacgagagtgataaacaaggcgcagcaatagtaaacccttatactgctatatctccacttaacttaatgcatgaagatgtttgtcacctag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45106517 |
ctcaaactatacgagagtgataaacaaggcgcagcaatagtaaacccatatactgctatatctccacttaacttaatgcatgaagatgtttgtcacctag |
45106418 |
T |
|
| Q |
101 |
cattggataaagtttcatcaattatatttcttccttttcataaaaaatggtcaagtgatggaaagcttggatatgatgacaaggacataaggtctttaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
45106417 |
cattggataaagtttcatcaattatatttcttccttttcataaaaaatggtcaagtgatggaaagcttgaatatgatgacaagaacataaggtctttaaa |
45106318 |
T |
|
| Q |
201 |
ccgcaacatcttggaaa |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45106317 |
ccgcaacatcttggaaa |
45106301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 81 - 161
Target Start/End: Original strand, 37840908 - 37840988
Alignment:
| Q |
81 |
tgaagatgtttgtcacctagcattggataaagtttcatcaattatatttcttccttttcataaaaaatggtcaagtgatgg |
161 |
Q |
| |
|
||||||||||||| | || ||||| || |||||| || | |||||| ||||||| ||||||| || ||||||||||||||| |
|
|
| T |
37840908 |
tgaagatgtttgtaatcttgcattagacaaagttgcaaccattataattcttccatttcatataacatggtcaagtgatgg |
37840988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 161
Target Start/End: Complemental strand, 38381360 - 38381280
Alignment:
| Q |
81 |
tgaagatgtttgtcacctagcattggataaagtttcatcaattatatttcttccttttcataaaaaatggtcaagtgatgg |
161 |
Q |
| |
|
||||||||||||| | || |||||||| |||||| || | || || ||||||| ||||||| || ||||||||||||||| |
|
|
| T |
38381360 |
tgaagatgtttgtaatcttgcattggacaaagttgcaaccatcatcattcttccatttcatataagatggtcaagtgatgg |
38381280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 161
Target Start/End: Complemental strand, 38398989 - 38398909
Alignment:
| Q |
81 |
tgaagatgtttgtcacctagcattggataaagtttcatcaattatatttcttccttttcataaaaaatggtcaagtgatgg |
161 |
Q |
| |
|
||||||||||||| | || |||||||| |||||| || | || || ||||||| ||||||| || ||||||||||||||| |
|
|
| T |
38398989 |
tgaagatgtttgtaatcttgcattggacaaagttgcaaccatcatcattcttccatttcatataagatggtcaagtgatgg |
38398909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University