View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_93 (Length: 234)
Name: NF17152_low_93
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_93 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 66 - 216
Target Start/End: Complemental strand, 47481219 - 47481069
Alignment:
| Q |
66 |
gcgtttgtgatattgagtttggcctcttaggattgaattatttgaacttgtatagtgacatataagtatttgtgaataataacttttgaaaatagtttat |
165 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47481219 |
gcgtttgtgatattgagttaggcctcttaggattgaattatttgaacttgtatagtgacatataagtatttgtgaataataacttttgaaaatagtttat |
47481120 |
T |
|
| Q |
166 |
agtttatactatatcgtttgatttatcttttgttataaaaatagttgatac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
47481119 |
agtttatactatatcgtttgatttatcttttgttagagaaatagttgatac |
47481069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 219
Target Start/End: Complemental strand, 871017 - 870985
Alignment:
| Q |
187 |
tttatcttttgttataaaaatagttgatacata |
219 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
871017 |
tttatcttttgttataaaaatagtttatacata |
870985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University