View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_94 (Length: 234)
Name: NF17152_low_94
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_94 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 50664073 - 50663954
Alignment:
| Q |
101 |
acaactttacccctgcaaatctttccgtatgatattttatttaattaatagatgtgtatgtaaatatagtttcttattattctggcaccctcttttgatc |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50664073 |
acaactttacccctgcagatctttccgtatgatattttatttaattaatagatgtgtatgtaaatatagtttcttattattctggcaccctcttttgatc |
50663974 |
T |
|
| Q |
201 |
cttaatataatagttaatag |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
50663973 |
cttaatataatagttaatag |
50663954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University