View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_97 (Length: 232)
Name: NF17152_low_97
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_97 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 13 - 108
Target Start/End: Complemental strand, 35377749 - 35377655
Alignment:
| Q |
13 |
gaatatgacctaccaatagannnnnnnattgttgtcgttggttgtggggaaatagtgtttacctacctcattcaatagttactgggttcagttcag |
108 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35377749 |
gaatatgacctaccaatagatttttt-attgctgtcgttggttgtggggaaatagtgtttacctagctcattcaatagttactgggttcagttcag |
35377655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 181 - 214
Target Start/End: Complemental strand, 35377582 - 35377549
Alignment:
| Q |
181 |
atataactttaggtctatttgttcaggtggagtg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35377582 |
atataactttaggtctatttgttcaggtggagtg |
35377549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University