View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_98 (Length: 230)
Name: NF17152_low_98
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_98 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 22 - 196
Target Start/End: Complemental strand, 47116769 - 47116595
Alignment:
| Q |
22 |
catctattgtggaaggattggggattcgttcattaacataacatcattgaatgagatgtatgacgtggaaattttctttgtaactgtctccccgaacttt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47116769 |
catctattgtggaaggattggggattcgttcattaacataacatcattgaatgagatgtatgacgtggaacttttctttgtaactgtctccccgaacttt |
47116670 |
T |
 |
| Q |
122 |
cagtaattaataccacaattagcacaaataatttctttcattttctctttccttaccagttttccaccaaataat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116669 |
cagtaattaataccacaattagcacaaataatttctttcattttctctttccttaccagttttccaccaaataat |
47116595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University