View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17153_low_14 (Length: 230)
Name: NF17153_low_14
Description: NF17153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17153_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 212
Target Start/End: Complemental strand, 5017230 - 5017034
Alignment:
| Q |
16 |
caatttggaggacattgttgtccgaattttctaaatccgaaatcggcaatacgaggctcaaagtcatcggctagtagaacgtttgatgttactagatgtc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017230 |
caatttggaggacattgttgtccgaattttctaaatccgaaatcggcaatacgaggctcaaagtcatcggctagtagaacgtttgatgttactagatgtc |
5017131 |
T |
|
| Q |
116 |
catgaacgacgggccttgatcctgcatggtggagaaatgctagaccacgcgctactcctagagcaatacggtgtcgtgttggccaccccattttttc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017130 |
catgaacgacgggccttgatcctgcatggtggagaaatgctagaccacgcgctactcctagagcaatacggtgtcgtgttggccaccccattttttc |
5017034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University