View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17153_low_7 (Length: 327)
Name: NF17153_low_7
Description: NF17153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17153_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 36 - 173
Target Start/End: Complemental strand, 34842414 - 34842277
Alignment:
| Q |
36 |
tcaaccaaattgttacctaaacacgattttttcgtataacattgaaaataaattaaaattaggttgcaaacatcttgaaacgtgtacaatcttcataatt |
135 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34842414 |
tcaaccaaattgttaactaaacacgatttttttgtataacgttgaaaataaattaaaattatgttgcaaacatcttgaaacgtatacaatcttcataatt |
34842315 |
T |
 |
| Q |
136 |
gttttcgaaatgcatgcataactcatcacataaaacaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34842314 |
gttttcgaaatgcatgcataactcatcacataaaacaa |
34842277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 187 - 259
Target Start/End: Complemental strand, 34838540 - 34838468
Alignment:
| Q |
187 |
tatagttcttggaagaaacccttgaatggttggtataagatacatgtggatggttctcattggtgttgggttg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34838540 |
tatagttcttggaagaaacccttgaatggttggtataagatacatgtggatggttctcattggtgttgggttg |
34838468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 313
Target Start/End: Complemental strand, 34838429 - 34838374
Alignment:
| Q |
258 |
tgatagaaacactaaaattccagcaacnnnnnnntatagagatattagaatttact |
313 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34838429 |
tgatagaaacactaaaattccagcaacaaaaaaatatagagatattagaatttact |
34838374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University