View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17154_high_11 (Length: 284)
Name: NF17154_high_11
Description: NF17154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17154_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 42667433 - 42667614
Alignment:
| Q |
1 |
tcttctttcctttcaaagattgttgcattttctcatccttcgttacaattaactttttattctttctctctgcagcagtgttattttttgttttctcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667433 |
tcttctttcctttcaaagattgttgcattttctcatccttcgttacaattaactttttattctttctctctgcagcagtgttattttttgttttctcaat |
42667532 |
T |
|
| Q |
101 |
cttttcagattgatgcgtttctgatccttgcttcttcttgttctttcctttcaaagacgtgtgtacttcaatgtccttgatg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667533 |
cttttcagattgatgcgtttctgatccttgcttcttcttgttctttcctttcaaagacgtgtgtacttcaatgtccttgatg |
42667614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 210 - 276
Target Start/End: Original strand, 42667642 - 42667708
Alignment:
| Q |
210 |
aagtttaagtccaatccacgataacggttaacatgagtatcatcgctaaatcgccactgttcatctc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667642 |
aagtttaagtccaatccacgataacggttaacatgagtatcatcgctaaatcgccactgttcatctc |
42667708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University