View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17154_high_18 (Length: 234)
Name: NF17154_high_18
Description: NF17154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17154_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 23 - 232
Target Start/End: Complemental strand, 53445241 - 53445032
Alignment:
| Q |
23 |
cttgagtttgattatgtctaatcgatattaaggatgatacattaatggaggactctgttttttgctggaaggatctccaatgagaccacatattaaatca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53445241 |
cttgagtttgattatgtctaatcgatattaaggatgatacattaatggaggactctgttttttgctggaaggatctccaatgagaccacatattaaaaca |
53445142 |
T |
|
| Q |
123 |
attgttggtttatttatttannnnnnngttagattggtttgaccataagaggctgcaagcaacattagttttatgtttttgttagttgttccttcgttct |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53445141 |
attgttggtttatttatttctttttttgttagattggtttgaccataagaggctgcaagcaacattagttttatgtttttgttagttgttccttcgttct |
53445042 |
T |
|
| Q |
223 |
ctaccctttg |
232 |
Q |
| |
|
||||| |||| |
|
|
| T |
53445041 |
ctaccatttg |
53445032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University