View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17154_low_14 (Length: 273)
Name: NF17154_low_14
Description: NF17154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17154_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 255
Target Start/End: Original strand, 5182684 - 5182922
Alignment:
| Q |
16 |
atagcgtgaaaatacataagctgcaaaatgtagcttatgtataaacgcacatccacttttcatacaccgccaaaacaaacagctactacatctttagctc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5182684 |
atagcgtgaaaatacataagctgcaaaatgtagtttatgtataaacgcacatccacttttcatacaccgccaaa-caaacagctactacatctttagctc |
5182782 |
T |
|
| Q |
116 |
gtacaacctttgctacctatacaannnnnnngtcaaggacttcgatatatagcgactcatcaattttgctctgatgtcaagtccatgacgtgataaatca |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5182783 |
gtacaacctttgctacctatacaatttgtttgtcaaggacttcgatatatagcgactcgtcaattttgctctgatgtcaagtccatgacgtgataaatca |
5182882 |
T |
|
| Q |
216 |
cctcgaaggccaagtagagttgtaaggttacagcagccct |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5182883 |
cctcgaaggccaagtagagttgtaaggttacagcagccct |
5182922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University