View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17154_low_15 (Length: 273)
Name: NF17154_low_15
Description: NF17154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17154_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 39300331 - 39300125
Alignment:
| Q |
16 |
cacagacgagagagatattcatgttgaaaaagacagagtcccaaagatgacaactcattttgaacaacttacagtggtagacaaggaaccaccacatggt |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300331 |
cacaaacgagagagatattcatgttgaaaaagacagagtcccaaagatgactacccattttgaacaacttacagtggtagacaaggaaccaccacatggt |
39300232 |
T |
|
| Q |
116 |
agcattgaagcattacaaggtggtgaaatgaacaaagatcatgcaggaaaagccattggagatattggtggaagaggaagatcaagagagactcatgaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300231 |
agcattgaagcattacaaggtggtgaaatgaacaaagatcatgcaggaaaagccattggagatattggtggaagaggaagatcaagagagactcatgaac |
39300132 |
T |
|
| Q |
216 |
ttggttc |
222 |
Q |
| |
|
||||||| |
|
|
| T |
39300131 |
ttggttc |
39300125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 173 - 222
Target Start/End: Complemental strand, 39299940 - 39299891
Alignment:
| Q |
173 |
ggagatattggtggaagaggaagatcaagagagactcatgaacttggttc |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39299940 |
ggagatattggtggaagaggaagagaaagagagagccatgaacttggttc |
39299891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University