View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17155_low_12 (Length: 211)
Name: NF17155_low_12
Description: NF17155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17155_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 4531674 - 4531857
Alignment:
| Q |
14 |
ttattcttgtggataacaaatacaatgttgtctcaaaaccaagcagaggaagcaattgttacaaacatgaatgagacagaacaagaaggtggttcaagtt |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4531674 |
ttatttttgtggataacaaatacaatgttgtctcaaaaccaagcagaggaagcaattgttacaaacatgaatgagacagaacaagaaggtggttcaagtt |
4531773 |
T |
|
| Q |
114 |
tagaagaaatagcagaagatcaatccatgttcaatttcaaaagtttcttatggcatggtggttctgtttgggatgcatggttta |
197 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4531774 |
tagaagaaatagcagaagaccaatccatgttcaatttcaaaagtttcttatggcatggtggttctgtttgggatgcatggttta |
4531857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 195
Target Start/End: Original strand, 24626308 - 24626339
Alignment:
| Q |
164 |
tggcatggtggttctgtttgggatgcatggtt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24626308 |
tggcatggtggttctgtttgggatgcatggtt |
24626339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University