View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17155_low_9 (Length: 237)
Name: NF17155_low_9
Description: NF17155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17155_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 44944408 - 44944196
Alignment:
| Q |
1 |
attttcttaattccatgcaataccctcccttgatctcctgcttgaacaactttgtattttcttaattccttagggacatattttatcgtgat----taat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44944408 |
attttcttaattccatgcaataccctcccttgatttccggcttgaacaactttatattttcttaattccttagggacatattttatcgtgattaattaat |
44944309 |
T |
 |
| Q |
97 |
agcaatcctcnnnnnnnnnnnnnnnnnnnnatcatgattaatggcgctattattcataggtttctagtcattttatctcttatggattttggtttcttct |
196 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44944308 |
agcaatcctctttttttagttattttttttatcatgattaatggcgctattattcataggtttctagtcattttatctcttatggattttggtttcttct |
44944209 |
T |
 |
| Q |
197 |
gcttcttaggtgt |
209 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44944208 |
gcttcttaggtgt |
44944196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University