View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17157_high_1 (Length: 233)
Name: NF17157_high_1
Description: NF17157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17157_high_1 |
 |  |
|
| [»] scaffold0449 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0449 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 2486 - 2699
Alignment:
| Q |
18 |
tcttgcgtatgcttctgcacctatttagatcaaatagcctcgagccaggatagctcacgcttattacgagcaggtctttgcagctcagcatatagctact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2486 |
tcttgcgtatgcttctgcacctatttagatcaaatagcctcgagccaggatagctcacgcttattacgagcaggtctttgcagctcagcatatagctact |
2585 |
T |
 |
| Q |
118 |
agggtcatagtcagcaaactcttccatatggggccacgttctagtgtcagcctagcttccatagctatgaggattgcagggaacgtccttgtcacggact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2586 |
agggtcatagtcagcaaactcttccatatggggccacgttctagtgtcagcctagcttccatagctatgaggattgcagggaacgtccttgtcacggact |
2685 |
T |
 |
| Q |
218 |
cacataacagtcca |
231 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
2686 |
catgtaacagtcca |
2699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 11086436 - 11086612
Alignment:
| Q |
18 |
tcttgcgtatgcttctgcacctatttagatcaaatagcctcgagccaggatagctcacgcttattacgagcaggtctttgcagctcagcatatagctact |
117 |
Q |
| |
|
|||||| ||||||||||||||||||| |||| |||| |||||||| ||||| || | ||||||||||||||||| ||||||||||| ||| |||||||| |
|
|
| T |
11086436 |
tcttgcttatgcttctgcacctattttgatccaatatcctcgagctaggattgcccgtgcttattacgagcaggtttttgcagctcatcatgtagctact |
11086535 |
T |
 |
| Q |
118 |
agggtcatagtcagcaaactcttccatatggggccacgttctagtgtcagcctagcttccatagctatgaggattgc |
194 |
Q |
| |
|
||||| | ||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
11086536 |
agggttaccatcagcgaactcttccatatggggccacgttctagtgtcagccttgcttcaatagctatgaggattgc |
11086612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University