View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17158_high_14 (Length: 458)
Name: NF17158_high_14
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17158_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 19 - 318
Target Start/End: Complemental strand, 41922124 - 41921825
Alignment:
| Q |
19 |
ttcattctgtcgcgttttcaactgcgtctcctctgccgacgaaagcgacaacggcggcgatcggttagcggcgttgagggagagtgatgtggagcataga |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41922124 |
ttcattctgtcgggttttcaactgcgtctcctctgccgacgaaagcgacaacggcggcgatcggttagcggcgttgagggagagtgatgtggagcataga |
41922025 |
T |
 |
| Q |
119 |
gaatgagatttttggagaacggaacgagttaactgagtggagtgagttgtgaacgagtgaatgagatgagagaatgagttagttgcgttagtgaagtgag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41922024 |
gaatgagatttttggagaacggaacgagttaactgagtggagtgagttgtgaacgagtgaatgagatgagagaatgagttagttgcgttagtgaagtgag |
41921925 |
T |
 |
| Q |
219 |
aatgtaaggttttgaatggtgaagtgggtttgggtttagaagaagggagagggattttgattgatgaagagatgaaacggatgtcgtcgttttgaggcat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41921924 |
aatgtaaggttttgaatggtgaagtgggtttgggtttagaagaagggagagggattttgattgatgaagagatgaaacggatgtcgtcgttttgaggcat |
41921825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 395 - 451
Target Start/End: Complemental strand, 41921742 - 41921685
Alignment:
| Q |
395 |
ttgcacttgcact-gcacggttgaattgaatgtgtttcgttaaccgctcgtgcctttg |
451 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41921742 |
ttgcacttgcacttgcacggttgaattgaatgtgtttcgttaatcgctcgtgcctttg |
41921685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University