View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17158_high_39 (Length: 262)
Name: NF17158_high_39
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17158_high_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 254
Target Start/End: Original strand, 7712932 - 7713177
Alignment:
| Q |
9 |
caagtatctttcttggtgctcgggcaggagttgttgcctatcaggttagccctaaaataagatattattgttccgatatcatgttgtgttgtgttatatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7712932 |
caagtatctttcttggtgctcgggcaggagttgttgcctatcaggttagccctaaaataagatattattgttccgatatcatgttgtgttgtgttatatg |
7713031 |
T |
 |
| Q |
109 |
aagtactaacatggacacggataacagacatgataccaacactgacacatagagagataacaatgcaggagtcctctttcttgttgggccttcggtacat |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7713032 |
aagtactgacatggacacggataacagacacgataccaacactgacatatagagagataccaatgcaggagtcctctttcttgtttggccttcggtacat |
7713131 |
T |
 |
| Q |
209 |
tgtcgcaactttgtctctttatgatgaatatagtaatgatattctt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7713132 |
tgtcgcaactttgtctctttatgatgaatatagtaatgatgttctt |
7713177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University