View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17158_high_46 (Length: 249)

Name: NF17158_high_46
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17158_high_46
NF17158_high_46
[»] chr3 (1 HSPs)
chr3 (1-237)||(45106499-45106735)


Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 45106499 - 45106735
Alignment:
1 cactctcgtatagtttgagacttaaaacaacattatcagagtatgagtcatgcaagtttaaagaaacaactttcttctttttgtgagaaatgaaaatggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45106499 cactctcgtatagtttgagacttaaaacaacattatcagagtatgagtcatgcaagtttaaagaaacaactttcttctttttgtgagaaatgaaaatggg 45106598  T
101 tgaagcccttccggctaactcgattaaatgcaaggcatctacggtgacaggatattctactatagggtcacatagatcaattacttcagtcataggagtt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45106599 tgaagcccttccggctaactcgattaaatgcaaggcatctacggtgacaggatattctactatagggtcacatagatcaattacttcagtcataggagtt 45106698  T
201 atgtggtgtggtttatgaatgcaaactagtatcttca 237  Q
    |||||||||||||||||||||||||||||||||||||    
45106699 atgtggtgtggtttatgaatgcaaactagtatcttca 45106735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University