View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17158_high_52 (Length: 240)

Name: NF17158_high_52
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17158_high_52
NF17158_high_52
[»] chr3 (1 HSPs)
chr3 (26-232)||(15994286-15994493)


Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 26 - 232
Target Start/End: Complemental strand, 15994493 - 15994286
Alignment:
26 gttatcttgcagcatgttgggtattgatgtagccgaggaggatgtgcacttgaggtattggagt-tgtttttgattgcaatgtcagggggatgtctatgt 124  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||| ||||||||||||||| | ||||  |||||||||||    
15994493 gttatcttgcagcatgttgggtattgatgtagctgaggaggatgtgcgcttgaggtattcgagtgtgtttttgattgcaacgccaggacgatgtctatgt 15994394  T
125 taatgtatttcccaaaggctatttaatcttggaggcatttggtgattaactttctgcataatttttgcagtatagtctattctttaattgcttaatgtat 224  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
15994393 taatgtatttcccaaaggctatttaatcttgaaggcatttggtgattaactttctgcataatttttgcagtatagtctattctttaattgcttaatgttt 15994294  T
225 gctctata 232  Q
    ||||||||    
15994293 gctctata 15994286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University