View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17158_high_54 (Length: 239)
Name: NF17158_high_54
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17158_high_54 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 239
Target Start/End: Original strand, 7906236 - 7906462
Alignment:
| Q |
13 |
catcactgctctgcgacgcctggttgatattttcatcctcaactgaaccaaatgatccatcatacacaatatcaactctgttggaattgaaagacatgta |
112 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906236 |
catcactgctctgcgacgcctcgttgatattttcatcctcaactgaaccaaatgatccatcatacacaatatcaactctgttggaattgaaagacatgta |
7906335 |
T |
 |
| Q |
113 |
atcaggctcaaaatattgcttatgattaacaagaatttgaaccaactcatcctcaagccttgacataacaacttgcaaaattccattagccctttgaaca |
212 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906336 |
atcaggctcaaaatattgcatatgattaagaagaatttgaaccaactcatcctcaagccttgacataacaacttgcaaaattccattagccctttgaaca |
7906435 |
T |
 |
| Q |
213 |
agttccttctgcttccaattttcattc |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7906436 |
agttccttctgcttccaattttcattc |
7906462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University