View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17158_high_60 (Length: 206)
Name: NF17158_high_60
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17158_high_60 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 36598166 - 36598000
Alignment:
| Q |
19 |
atgttggatgtgtctatcgtatgatgtcacctgcttccaggtcctaaattggacccgagtccaaaccagatggattttgacccagttcaaaacaattgta |
118 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||| |||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36598166 |
atgttggatgtgtctattgtatgatgtcgcctgctcccaggttctaaatcggacccgagtccaaaccagatggattttgaccgagttcaaaacaattgta |
36598067 |
T |
|
| Q |
119 |
aatttaactattaacgttacaaaactagatatttaatgttaaaaaatatatattgtagtgcatccat |
185 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36598066 |
aatttaattattaacattacaaaactagatatttaatgttaaaaaatatatattgtagtacatccat |
36598000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University