View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17158_high_61 (Length: 201)
Name: NF17158_high_61
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17158_high_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 50 - 186
Target Start/End: Complemental strand, 38554575 - 38554439
Alignment:
| Q |
50 |
tcttaaaaatttctaataacgtacatgtataggagccatattatatgatattatgattatcaaaaaaggaatcagggtaatgtcatgccataaaaatata |
149 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38554575 |
tcttaaaaatttctaataacttacatgtataggagccatattatatgatattataattatcaaaaaaggaatcagggtaatgtcatgccataaaaatata |
38554476 |
T |
 |
| Q |
150 |
tagagaatagctaatgcataaatacagaataaaaagt |
186 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38554475 |
tagagaataggtaatgcataaatacagaataaaaagt |
38554439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University