View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17158_low_23 (Length: 400)
Name: NF17158_low_23
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17158_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 267
Target Start/End: Original strand, 45341487 - 45341736
Alignment:
| Q |
18 |
cacgcataacttatggatgaccctttgaaagaaacatgttcttgtctgacacttcagagaccaaagatacataataaagagggaaaataacataaatagg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341487 |
cacgcataacttatggatgaccctttgaaagaaacatgttcttgtctgacactgcagagaccaaagatacataataaagagggaaaataacataaatagg |
45341586 |
T |
 |
| Q |
118 |
tgtggagagaaaggtggaacaccaacaaattttgtgaggagtgaggacacagcaaaaatgcagctaattaaccatggatcgtggatgctgcagaggtcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341587 |
tgtggagagaaaggtggaacaccaacaaattttgtgaggagtgaggacacagcaaaaatgcagctaattaaccatggatcgtggatgctgcagaggtcat |
45341686 |
T |
 |
| Q |
218 |
tgcaactccggatcttttacgatcttcagttttgtgctcgtaagagcgat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341687 |
tgcaactccggatcttttacgatcttcagttttgtgctcgtaagagcgat |
45341736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 330 - 389
Target Start/End: Original strand, 45341799 - 45341858
Alignment:
| Q |
330 |
tgtaagcggtttgggcaaaaccaatgaagccggaaaatcaaacaaaagttatccgatatt |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45341799 |
tgtaagcggtttgggcaaaaccaatgaagccggaaaatcaaacaaaagttatcccatatt |
45341858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University