View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17158_low_38 (Length: 297)
Name: NF17158_low_38
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17158_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 835874 - 835597
Alignment:
| Q |
1 |
taagtagcttaccctagaggcaaagaaatagaagcaggacccgaaaactctccgggttgaattgctttcagatttgaaccaaataatattttagcttcgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
835874 |
taagtagcttaccctagaggcaaagaaatagaagcaggacccgaaaactctccgggttgaatttctttcagatttgaaccaaataatattttagcttcgt |
835775 |
T |
|
| Q |
101 |
tcaagaatgagacggaataaaacggcctgacaaagtcatgatggtcaatatgaggaggaatgcagtcccctacatcatatatgttgacaatgcaactgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
835774 |
tcaagaatgagacggaataaaacggcctgacaaagtcatgatggtcaatgtgaggaggaatgcagtcccctacatcatatatgttgacaatgcaactgtc |
835675 |
T |
|
| Q |
201 |
aggaacacacgtcggaggaattatgttccatctaaccattctctttatcatttgcttgaacacgtccggcaaaggatc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
835674 |
aggaacacacgtcggaggaattatgttccatctaaccattctctttatcatttgcttgaacacgtccggcaaaggatc |
835597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 262
Target Start/End: Complemental strand, 814123 - 813880
Alignment:
| Q |
19 |
ggcaaagaaatagaagcaggacccgaaaactctccgggttgaattgctttcagatttgaaccaaataatattttagcttcgttcaagaatgagacggaat |
118 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||| || ||| ||||||| |||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
814123 |
ggcaaagaaatcgaagcgggaccaaaaaactctcctggacgaacagctttcaaatttgaaccaaataatattttagctttgttcaagaaagagacggaat |
814024 |
T |
|
| Q |
119 |
aaaacggcctgacaaagtcatgatggtcaatatgaggaggaatgcagtcccctacatcatatatgttgacaatgcaactgtcaggaacacacgtcggagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
814023 |
aaaacggcctgacaaagtcatgatggtcaatatgaggaggaatgcagtcccctacatcatatatgttgacaatgcaactgtcaggaacacacgtcggagg |
813924 |
T |
|
| Q |
219 |
aattatgttccatctaaccattctctttatcatttgcttgaaca |
262 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
813923 |
aattattttccatctaaccatcctctttatcatttgcttgaaca |
813880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University