View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17158_low_46 (Length: 254)
Name: NF17158_low_46
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17158_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 13100423 - 13100183
Alignment:
| Q |
1 |
tcacgcgcgcgtccggttgagattgcggcagtgtactcactcgcgggtaaacccgctccaattgaaccgggttcaattaaaattggtgatttatacgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13100423 |
tcacgcgcgcgtccggttgagattgcggcagtgtactcactcgcgggtaaacccgctccaattgaaccgggttcaattaaaattggtgatttatacgctg |
13100324 |
T |
 |
| Q |
101 |
aagaagaaagggagttattattggagcttaaagtgccggctgtgtcagctgggtcccaccatgttttaacagttttatcttcttaccgtgacacagtaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13100323 |
aagaagaaagggagttattattggagcttaaagtgccggctgtgtcagctgggtcccaccatgttttaacagttttatcttcttaccgtgacacagtaac |
13100224 |
T |
 |
| Q |
201 |
tcgtgagattgtgaaaccctttgagcaagcaatgttgattc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13100223 |
tcgtgagattgtgaaaccctttgagcaagcaatgttgattc |
13100183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 13030240 - 13030000
Alignment:
| Q |
1 |
tcacgcgcgcgtccggttgagattgcggcagtgtactcactcgcgggtaaacccgctccaattgaaccgggttcaattaaaattggtgatttatacgctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13030240 |
tcacgcgcgcgtccggttgagattgcggcagtgtactcactcgcgggtaaacccgctccaattgaaccgggttcaattataattggtgatttatacgctg |
13030141 |
T |
 |
| Q |
101 |
aagaagaaagggagttattattggagcttaaagtgccggctgtgtcagctgggtcccaccatgttttaacagttttatcttcttaccgtgacacagtaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13030140 |
aagaagaaagggagttattattggagcttaaagtgccggctgtgtcagctgggtcccaccatgttttaacagttttatcttcttaccgtgacacagtaac |
13030041 |
T |
 |
| Q |
201 |
tcgtgagattgtgaaaccctttgagcaagcaatgttgattc |
241 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13030040 |
tcgtgagattgggaaaccctttgagcaagcaatgttgattc |
13030000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University