View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17158_low_49 (Length: 250)
Name: NF17158_low_49
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17158_low_49 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 35 - 250
Target Start/End: Complemental strand, 45889416 - 45889201
Alignment:
| Q |
35 |
attaatatgacattaaatctaaatttaatctttgatctgaatattttcgatgatacaccaatttgtgtatgtttgcttggatggagggtcttgcgtttgt |
134 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45889416 |
attaatatgacattaaatctgaatttaatctttgatctgaatattttcgatgatacaccaatttgtgtatgtttgcttggatggagggtcttgcgtttgt |
45889317 |
T |
 |
| Q |
135 |
caaactcatggtgttactgcgagattataaaaattatggtggctttgatttagtagaagttataaaatgtaacttttgtttttgttaaaattacggattt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45889316 |
caaactcatggtgttactgcgagattatataaattatggtggctttgatttagtagatgttataaaatgtaacttttgtttttgttaaaattacggattt |
45889217 |
T |
 |
| Q |
235 |
attatgattttgagtt |
250 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45889216 |
attatgattttgagtt |
45889201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University