View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17158_low_57 (Length: 240)
Name: NF17158_low_57
Description: NF17158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17158_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 26 - 232
Target Start/End: Complemental strand, 15994493 - 15994286
Alignment:
| Q |
26 |
gttatcttgcagcatgttgggtattgatgtagccgaggaggatgtgcacttgaggtattggagt-tgtttttgattgcaatgtcagggggatgtctatgt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||| ||||||||||||||| | |||| ||||||||||| |
|
|
| T |
15994493 |
gttatcttgcagcatgttgggtattgatgtagctgaggaggatgtgcgcttgaggtattcgagtgtgtttttgattgcaacgccaggacgatgtctatgt |
15994394 |
T |
 |
| Q |
125 |
taatgtatttcccaaaggctatttaatcttggaggcatttggtgattaactttctgcataatttttgcagtatagtctattctttaattgcttaatgtat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
15994393 |
taatgtatttcccaaaggctatttaatcttgaaggcatttggtgattaactttctgcataatttttgcagtatagtctattctttaattgcttaatgttt |
15994294 |
T |
 |
| Q |
225 |
gctctata |
232 |
Q |
| |
|
|||||||| |
|
|
| T |
15994293 |
gctctata |
15994286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University