View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17159_high_13 (Length: 323)
Name: NF17159_high_13
Description: NF17159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17159_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 29606749 - 29606455
Alignment:
| Q |
1 |
ggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttaggggatggggtttttgggcttaatgccggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606749 |
ggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttaggggatggggtttttgggcttaatgccggtg |
29606650 |
T |
 |
| Q |
101 |
taacctttgggactggcaactttacaggagcgagttttggaggatccggaactggtgatttgacaggagcagttgttggaggttttgattttggaactgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606649 |
taacctttgggactggcaactttacaggagcgagttttggaggatccggaactggtgatttgacaggagcagttgttggaggttttgattttggaactgg |
29606550 |
T |
 |
| Q |
201 |
tggtttcacaggagaaggttttggtgcgggagctttcggaactggtggtttcaaaggagcagatgttggagttgtagtttttggaactattggtt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606549 |
tggtttcacaggagaaggttttggtgcgggagctttcggaactggtggtttcaaaggagcagatgttggagttgtagtttttggaactattggtt |
29606455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 238 - 288
Target Start/End: Complemental strand, 29606377 - 29606327
Alignment:
| Q |
238 |
ggaactggtggtttcaaaggagcagatgttggagttgtagtttttggaact |
288 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| |||| |||||||||| |
|
|
| T |
29606377 |
ggaactggcggtttcacaggagcagatgttggagtcgtagcttttggaact |
29606327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University