View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_106 (Length: 324)
Name: NF1715_high_106
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_106 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 324
Target Start/End: Original strand, 33947950 - 33948273
Alignment:
| Q |
1 |
attaatgatagcaaggaaaacaattggtagtctagtaaaggctgctccttctaaaaaccagtctagtccttcactcaaaagtcaatctttcccactcata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33947950 |
attaatgatagcaaggaaaacaattggtagtctagtaaaggctgctccttctaaaaaccagtctagtccttcactcaaaagtcaatctttcccactcata |
33948049 |
T |
|
| Q |
101 |
cccccctctttcctctatccttccccacttcccttctctatataatcaccccttcacattccaaccgacacccattttccatttccaccatagcaactgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948050 |
cccccctctttcctctatccttccccacttcccttctctatataatcaccccttcacattccaaccgacacccattttccatttccaccatagcaactgt |
33948149 |
T |
|
| Q |
201 |
ttggtttggaatttggttccacaaacaagcatggaggttgttctaccagttgcaccacctactcctccaatagacttcaacttcgacagtaactgttcct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33948150 |
ttggtttggaatttggttccacaaacaaacatggaggttgttctaccagttgcaccacctactcctccagtagacttcaacttcgacagtaactgttcct |
33948249 |
T |
|
| Q |
301 |
ctccttacatcactgctccttctt |
324 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33948250 |
ctccttacatcactgctccttctt |
33948273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University