View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_135 (Length: 289)
Name: NF1715_high_135
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_135 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 18 - 176
Target Start/End: Complemental strand, 39383434 - 39383276
Alignment:
| Q |
18 |
acgagtgtggttaaagatcaagggaaacttagacaacacaacttagttggtatcttcaagagactcatatccgaccctatatattatctaagtaaagact |
117 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
39383434 |
acgagtgtggttaaacatcaaggaaaacttagacatcgcaacttagttggtatcttcaagagactcatatccgaccctatatattatctcaggaaagact |
39383335 |
T |
 |
| Q |
118 |
aaacgtacaagtcatattatcaattgaaaaagaaataatgaacaaagtcgattattagt |
176 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39383334 |
aaacgtacgagtcatattatcaattgaaaaagaaataatgaacaaagtcgattattagt |
39383276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 206 - 248
Target Start/End: Complemental strand, 39383241 - 39383199
Alignment:
| Q |
206 |
atgttttaaagtttaaacataacatagattcttttagagattt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39383241 |
atgttttaaagtttaaacataacatagattcttttagagattt |
39383199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University