View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_137 (Length: 282)
Name: NF1715_high_137
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_137 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 5179648 - 5179787
Alignment:
| Q |
20 |
ttgctgaattttggtaacttgtgttgcttgtttcatgtgttataagtcatgatttaccgtcaacttggtgaagttaatcgttctggaattacatgcatag |
119 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||| | | |
|
|
| T |
5179648 |
ttgctgagttttggtaacttgttttgcttgtttcatgtcttataagtcatgactta-cgtcaacttggtgaagttaatctttctggaattacatgaaccg |
5179746 |
T |
 |
| Q |
120 |
aagctgcagaaattaatgatgctttgattgttaccaaaatgtaa |
163 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5179747 |
aagctgcagaaat---tgatgctttgattgttaccaaaatgtaa |
5179787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 186 - 255
Target Start/End: Original strand, 5179887 - 5179956
Alignment:
| Q |
186 |
atggttataaaatgtaaacaaaataaccaaatgaaatgtacgtcacgttctttgatagcaggctaacatg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
5179887 |
atggttataaaatgtaaacaaaataaccaaatgaaatgtacgtcatgttctttgatagtgggctaacatg |
5179956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 110
Target Start/End: Complemental strand, 5056252 - 5056162
Alignment:
| Q |
20 |
ttgctgaattttggtaacttgtgttgcttgtttcatgtgttataagtcatgatttaccgtcaacttggtgaagttaatcgttctggaatta |
110 |
Q |
| |
|
||||||||| || ||||||||| ||||| || ||||||| | |||||||||| | ||||||||||||| |||||||| |||| |||||| |
|
|
| T |
5056252 |
ttgctgaatctttgtaacttgttttgctggtgtcatgtgctctaagtcatgactcgccgtcaacttggttgagttaatctttctagaatta |
5056162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 196
Target Start/End: Complemental strand, 5056078 - 5056047
Alignment:
| Q |
165 |
agtataaacatcataactaaaatggttataaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5056078 |
agtataaacatcataactaaaatggttataaa |
5056047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University