View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_140 (Length: 280)
Name: NF1715_high_140
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_140 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 24 - 268
Target Start/End: Original strand, 47558704 - 47558950
Alignment:
| Q |
24 |
tgaatgtgttaaactgtgtaatttaagaaagactt--aataattgattgatattatctatgtttacaagatgcatgctcctttttggaggtctagatttg |
121 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47558704 |
tgaatgtattaaactgtgtaatttaagaaagacttgtaataattgattgatattatctatgtttacaagatgcatgctcctttttggaggtctagattgg |
47558803 |
T |
|
| Q |
122 |
aataattacgtagtttggtgtacatgtgaaatgagtgatattcataaacgttttgcattgccaattttaatgatatggagtcttcggttatggggtttga |
221 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
47558804 |
aataattacgtagtttggtgtacatatgagatgagtgatattcataaacgttttgcattgccaattttaatgatatggagtcttcggttatggggttcga |
47558903 |
T |
|
| Q |
222 |
acgtatgtgttgtcgtttgatggcgtgtgcgtgttacttatcatttc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47558904 |
acgtatgtgttgtcgtttgatggcgtgtgcatgttacttatcatttc |
47558950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University