View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_152 (Length: 259)
Name: NF1715_high_152
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_152 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 32 - 244
Target Start/End: Original strand, 39275672 - 39275884
Alignment:
| Q |
32 |
gccattgccatggccatggttgttgttaccaaagccatgtccattagacatgctatcctgatgaaacatgttgtggtttcctcctatattggagccatgg |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39275672 |
gccattgccatggccatggttgttgttaccaaagccatgtccattagacatgctatcctgatgaaacatgttgtggtttcctcctatattggagccatgg |
39275771 |
T |
 |
| Q |
132 |
ccatgatgttttgaaaaagagtgatcagattctttgccaaaaccacctggcttcgtgtgcatggcagggagtggaaattgttgcttatcgtagtagttgc |
231 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39275772 |
ccatgatgttttgaaaaagaatgatcagattctttgccaaaaccacctggcttcatgtgcatggcagggagtggaaattgttgcttatcgtagtagttgc |
39275871 |
T |
 |
| Q |
232 |
tatggtcagtggt |
244 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39275872 |
tatggtcagtggt |
39275884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University