View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_163 (Length: 249)
Name: NF1715_high_163
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_163 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 10 - 234
Target Start/End: Complemental strand, 2547912 - 2547688
Alignment:
| Q |
10 |
aagaaaatcatgtgggatatttaaccataggtttctattcataggtggcattttgtgtttcatccatggattgttcaccgttccttattatgtttctgcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2547912 |
aagaaaatcatgtgggatatttaaccataggtttctattcataggtggcattttgtgtttcatccatggattgttcaccgttccttattatgtttctgcc |
2547813 |
T |
 |
| Q |
110 |
acagccaccagaagagaagaaaagaggcaattagaaagcctggggcccgccgtaagacgaacttaattaattagaatttcaccaaaacgttgctaattgc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2547812 |
acagccaccagaagagaagaaaagaggcaattagaaagcctggggcccgccgtaagacgaacttaattaattagaatttcaccaaaacgttgctaattgc |
2547713 |
T |
 |
| Q |
210 |
ttgcttgctgcatatgaaatgtaca |
234 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2547712 |
ttgcttgctgcatatgaaatgtaca |
2547688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 10 - 130
Target Start/End: Original strand, 36574340 - 36574460
Alignment:
| Q |
10 |
aagaaaatcatgtgggatatttaaccataggtttctattcataggtggcattttgtgtttcatccatggattgttcaccgttccttattatgtttctgcc |
109 |
Q |
| |
|
|||| |||| |||||||||| || ||| ||||| ||| ||| || || ||||| |||||||| ||||||||||| || ||| ||||||||||||| || |
|
|
| T |
36574340 |
aagagaatcttgtgggatatcaaatcatcggtttttatccattggagggattttatgtttcattcatggattgtttactgttgcttattatgtttcagca |
36574439 |
T |
 |
| Q |
110 |
acagccaccagaagagaagaa |
130 |
Q |
| |
|
|| ||||| ||||| |||||| |
|
|
| T |
36574440 |
acggccacaagaagggaagaa |
36574460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University