View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_167 (Length: 246)
Name: NF1715_high_167
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_167 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 39836713 - 39836951
Alignment:
| Q |
1 |
tatcttaagttaaggcttgagacacttccttggatgaaggtcaaggaacttcttaattatctatatgtaggcatagacactatttggtgttatccaaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39836713 |
tatcttaagttaaggcttgagacacttccttggatgaaggtcaaggaacttcttaattatctatatgtaggcatagacactatttggtgttatccaaaga |
39836812 |
T |
 |
| Q |
101 |
acacttagatgagacggtataaaaactctctttcgatttaaccagaggttttgggttcaaatccagttttgggaatgtaacggtgttaaatcacttgcca |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39836813 |
acacttagatgatacggtataaaaactctctttcgatttaaccagaggttttgagttcaaatccagttttgggaatgtaacggtgttaaatcacttgcca |
39836912 |
T |
 |
| Q |
201 |
cccgttgcgatcctaccaatctcgaaggattactctctg |
239 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39836913 |
cccgttgcgatcctaccaatctcaaaggattactctctg |
39836951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University