View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_169 (Length: 245)
Name: NF1715_high_169
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_169 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 8 - 229
Target Start/End: Original strand, 43891332 - 43891552
Alignment:
| Q |
8 |
taacataattttgatctccaaatttgcactccacatgtaattaccaatagtcaaactcatcttgttcaagtggcttatgattaattgtgtcaatgaaaaa |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
43891332 |
taacataattttgatctccaagtttgcactccacatgtaattaccaatagtcaaacttatcctgttcaagtggcttatgatt----gtgtcaatgaaaaa |
43891427 |
T |
 |
| Q |
108 |
tattatttgagagagaagtatgaggaagcactcttgatcaaaccatatttctatgtggcattgttagctttgaggcgacgataatttgaaat---ttcat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43891428 |
tattatttgagagagaagtatgaggaagcactcttgatcaaaccatatttctatgtggcattgttagctttgaggcgacgataatttgaaatggcttcat |
43891527 |
T |
 |
| Q |
205 |
tgatattttgcatttctatgaaaat |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43891528 |
tgatattttgcatttctatgaaaat |
43891552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 118 - 162
Target Start/End: Complemental strand, 55533545 - 55533501
Alignment:
| Q |
118 |
gagagaagtatgaggaagcactcttgatcaaaccatatttctatg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55533545 |
gagagaagtatgaggaagcactcttgatcaaacctgatttctatg |
55533501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University