View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_182 (Length: 240)
Name: NF1715_high_182
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_182 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 20 - 222
Target Start/End: Complemental strand, 9500113 - 9499907
Alignment:
| Q |
20 |
gtaaaagaatgcaaaaacagggggcggtagagtttaaattacacaacatcacacnnnnnnnnga------aagttatgcaaaaacagaacaaagctcact |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||| |
|
|
| T |
9500113 |
gtaaaagaatgcaaaa-cagggggcggtagagtttaaattacacaacatcacacacaaaaaaaagaacataagttatgcaaaa-cagaacaaagctcact |
9500016 |
T |
|
| Q |
114 |
gacatgtgaaaaaagaacagtgggagggatggccagcaacataccagaacggtcagcaaacagtaataaacaacaacctagccttatcccactaagtgga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9500015 |
gacatgtgaaaaaagaacagtgggagggatggccagcaacataccagaacggtcagcagacagtaataaacaacaacctagccttatcccactgagtgga |
9499916 |
T |
|
| Q |
214 |
tcaaacgac |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
9499915 |
tcaaacgac |
9499907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University