View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1715_high_187 (Length: 238)

Name: NF1715_high_187
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1715_high_187
NF1715_high_187
[»] chr1 (1 HSPs)
chr1 (19-238)||(26969670-26969889)


Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 26969670 - 26969889
Alignment:
19 tgttgttgggtctcttttgccaactacggcttctcttgcattctcgtaggtgtcctgaacagccttcatcactgatccaattacaccgggcttctcttga 118  Q
    |||||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||    
26969670 tgttgttgggtcccttttgccaactacagcttctcttgcattctcgtaggtgtcatgaacagccttcatcactgaaccaattacaccgggcttctcttga 26969769  T
119 tcatgttgttcttttgttacactga-tttcttcaacgtgtcttggttgttttgatgccatttgaagaagaagaattaatgtagctttagtttttgttgtg 217  Q
    ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
26969770 tcatgttgttcttttgtta-actgattttcttcaacgtgtcttggttgttttgatcccatttgaagaagaagaattaatgtagctttagtttttgttgtg 26969868  T
218 tttttcttttctagtaagata 238  Q
    | |||||||||||||||||||    
26969869 tgtttcttttctagtaagata 26969889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University