View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_189 (Length: 237)
Name: NF1715_high_189
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_189 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] scaffold0130 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 38389636 - 38389729
Alignment:
| Q |
19 |
taagtgcagcaaggcgagataaatagagccaattataactactttgatgttttaagtagtca-gcttggatttaacagctctaaaagaaactct |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38389636 |
taagtgcagcaaggcgagataaatagagccaattataactactacgatgttttaagtagtcacgcttggatttaacagctctaaaagaaactct |
38389729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 179 - 237
Target Start/End: Original strand, 40572058 - 40572116
Alignment:
| Q |
179 |
ctggagtatcaatagcctcgtgattggacaaatcgatcgtcgaagctggattggtattc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40572058 |
ctggagtatcaatagcctcgtgattggacaaattgatcgtcgaagctggattggtattc |
40572116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 179 - 237
Target Start/End: Original strand, 19913564 - 19913622
Alignment:
| Q |
179 |
ctggagtatcaatagcctcgtgattggacaaatcgatcgtcgaagctggattggtattc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19913564 |
ctggagtatcaatagcctcgtgattggacaaattgatcgtcgaagctggattggtattc |
19913622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0130 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0130
Description:
Target: scaffold0130; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 179 - 237
Target Start/End: Original strand, 18757 - 18815
Alignment:
| Q |
179 |
ctggagtatcaatagcctcgtgattggacaaatcgatcgtcgaagctggattggtattc |
237 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18757 |
ctggagtatcaatagcctcgtgtttggacaaatcgatcatcgaagctggattggtattc |
18815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 180 - 237
Target Start/End: Original strand, 10776629 - 10776686
Alignment:
| Q |
180 |
tggagtatcaatagcctcgtgattggacaaatcgatcgtcgaagctggattggtattc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
10776629 |
tggagtatcaatagcctcgtgattggacaaattgatcttcgaagctggattgatattc |
10776686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University