View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_193 (Length: 235)
Name: NF1715_high_193
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_193 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 91 - 218
Target Start/End: Original strand, 18667841 - 18667965
Alignment:
| Q |
91 |
atgtagcgaatggagttgtcccggaaatatcacgaatgnnnnnnnnn-aaggagagaatatcacgaatgttgtttttatattaatatccttcttatctaa |
189 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||| ||| |
|
|
| T |
18667841 |
atgtggcgaatggagttgtcccggaaatatcacgaatgttttttttttaaggagagaatatcacgaat-----ttttatattaatatccttcctatataa |
18667935 |
T |
 |
| Q |
190 |
ctaggatt-aaaaaatttcttgttgtttta |
218 |
Q |
| |
|
|||||||| |||||| |||||||||||||| |
|
|
| T |
18667936 |
ctaggattaaaaaaaattcttgttgtttta |
18667965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 33 - 69
Target Start/End: Original strand, 18667811 - 18667847
Alignment:
| Q |
33 |
gagtgacttatttgatacggcaaatattgcatgtggc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18667811 |
gagtgacttatttgatacggcaaatattgcatgtggc |
18667847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University