View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_196 (Length: 234)
Name: NF1715_high_196
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_196 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 51915645 - 51915436
Alignment:
| Q |
19 |
ccattctccaatcttcttc---ttctgattctctactttacacctacactcacgcttacaacggtttcgctgtttcccttgacactaaacaagtgcaaga |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51915645 |
ccattctccaatcttcttcttcttctgattctctactttacacctacactcacgcttacaatggtttcgctgtttcccttgacactaaacaagtgcaaga |
51915546 |
T |
 |
| Q |
116 |
actgcgtagttctgattcagttctgggtgtatatgaagatactctgtactcactgcacactacccgcaccccagagtttctgggtctgcttcaaattcaa |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51915545 |
actgcgtagttctgattcagttctcggtgtatatgaagatactctgtactcactgcacactacccgcaccccagagtttctgggtctgcttcaaattcaa |
51915446 |
T |
 |
| Q |
216 |
acccattctc |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
51915445 |
acccattctc |
51915436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University