View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_198 (Length: 234)
Name: NF1715_high_198
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_198 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 40782921 - 40782842
Alignment:
| Q |
1 |
ctccaaaagggtcttcagatagtccggctgatgattcgagtgctgttggtttgaatggctacatagttaatggtgctaca |
80 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40782921 |
ctccaaaagggtcttcggatagtccggctgatgattcgagtgctgttggtttgaatggctacatagttaatggtgctaca |
40782842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 193 - 228
Target Start/End: Complemental strand, 40782729 - 40782694
Alignment:
| Q |
193 |
ccttgagccagtttgagttgattgatgatgatgatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40782729 |
ccttgagccagtttgagttgattgatgatgatgatg |
40782694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University